Evidence of horizontal gene-transfer, by IS element, in the recruitment and establishment of HCH catabolic pathway in Streptomyces sp. M7.

CUOZZO, SERGIO; BENIMELI, CLAUDIA; AMOROSO, MARÍA JULIA; ABATE, CARLOS

New Castle-Inglaterra

Simposio; 14th International Symposium on the Biology of actinomycetes; 2007

Sociedad Internacional de Biología de actinomycetes

Streptomyces M7 isolated from Argentina(1), capable of metabolizing g-HCH under aerobic conditions, was characterized by morphological and biochemical tests, along with 16S rRNA gene analysis. By alkaline lysis procedure (3) as well as Pulsed Field Gel Electrophoresis, plasmids were not detected. Concluding that the lin genes, responsible for lindane metabolism, would be present at chromosome level. Because these results the presence of lin genes were investigated by PCR, using primers designed from lin genes of Sphingobium japonicum UT26(1), founding similar negative results; may due to the high level mutation frequency. It’s well known that Sphingomonas lindane degradation is codified by lin operon and also this capacity is transmissible to other Gram (-) bacteria by a IS 6100. The IS sequence was used to design the IS6100F21 5´GGACGGAACGATGACGGATT3´ and IS6100R788 5´CTGCTGCGAAATGGTGGTT3´ primers. The size of amplification fragments obtained was according to the expected 880 bp (2). The presence of the insertion sequence IS6100 in M7 had been detected, adds another factor that might to have contributed at the extraordinary spread of lin genes among HCH-degrading not only in the Gram (–) bacteria , but also in Gram (+) as our Streptomyces sp. M7 isolated in Argentina. These preliminary results about of partial characterization of IS6100 in Streptomyces sp. M/ are a contribution to the best understand in the distribution of g-HCH degradation genes around of the world in the different microorganisms.