INVESTIGADORES
IRAZUSTA Veronica Patricia
congresos y reuniones científicas
Título:
Recreational water in Salta, Argentina, presence of pathogenic free living amoebae
Autor/es:
JUAREZ, MARÍA MERCEDES; SANGUINO JORQUERA, DIEGO; POMA, RAMIRO HUGO; IRAZUSTA VERÓNICA; RAJAL VERÓNICA
Lugar:
Singapur
Reunión:
Congreso; 15th International Congress of Bacteriology and Applied Microbiology, 15th International Congress of Mycology and Eukaryotic Microbiology and 17th International Congress of Virology; 2017
Institución organizadora:
15th International Congress of Bacteriology and Applied Microbiology, 15th International Congress of Mycology and Eukaryotic Microbiology and 17th International Congress of Virology
Resumen:
Objectives: This work aims to study the presence of pathogenic free living amoebae (FLA) in the Vaqueros River located in Salta, northwest of Argentina. We have based on four important facts: 1) there are three genera of FLA ubiquitous that can cause serious and even fatal diseases in humans: Acanthamoeba, Naegleria y Balamuthia, 2) only Acanthamoeba includes pathogenic and no pathogenic strains (the other two genera have only one strain), 3) water is a possible vehicle of transmission, and 4) this aquatic ambient is used extensively for recreational activities during spring and summer. Methods: Twenty-liter water samples were collected from four sites along the river during dry and wet season (October and December, respectively). Samples were concentrated by ultrafiltration using a portable device with a hollow fiber unit. The retentate obtained was cultured in Non-Nutrient Agar and incubated a 30 °C for 15 days, observing the development of colonies daily under the optical microscope for its isolation. Later, each strain was growth axenically to be able to amplify a 400 bp 18S DNA fragment. The primers used [JDP1 (5′GGCCCAGATCGTTTACCGTGAA3′) and JDP2 (5′TCTCACAAGCTGCTAGGGAGTCA3′)] allowed the classification of Acanthamoeba strains into pathogenic and non-pathogenic after PCR products were sequenced. Results: A total of thirty two strains of FLA were isolated from all the environmental samples by its characteristic microscopic morphology. Only nine of them were amplified by PCR, showing that they belong to Acanthamoeba genera. Although it is necessary to carry out more studies for the identification of the strains that did not amplify, they most likely belonged to the Naegleria genus, because Balamuthia is not able to grow in a culture media rather than in a cell culture. Seasonal distribution showed that most of the FLA isolates were obtained during the wet season (75%), but all of the Acanthamoeba strains were only found in the dry season. The results of sequencing give high homology to isolates with strains that belonged to T4 genotype from the Genbank. Further, strains have also high homology between themselves. Conclusion: Like in previous studies, T4 demonstrated to be the predominant genotype in environmental samples, being in our case the only one isolated. We wonder if this predominance of Acanthamoeba T4 species may be influenced by the fact that it is easily cultivated in the laboratory. A comparative metagenomic analysis could help to clear this question. T4 species are also predominant in clinical isolations, situations who demands more awareness within the public and health professionals as this pathogen is emerging worldwide as a risk for human health