Subcloning of AT1 Angiotensin II Receptor

MANZUR, MJ, ALVAREZ, SE Y CIUFFO, GM

CICUNC Universidad Nacional de Cuyo, Mendoza

Congreso; XXI Reunión Científica Anual de la SOCIEDAD DE BIOLOGÍA DE CUYO; 2003

Subcloning of the AT1 Angiotensin II receptor. Manzur MJ, Alvarez SE and Ciuffo GM. Bioquímica Avanzada. Facultad de Quimica, Bioquímica y Farmacia. Universidad Nacional de  San Luis. Angiotensin II (Ang II) exerts its physiological effects through the binding to membrane receptors, classified by their pharmacological characteristics in AT1 and AT2 receptors. Ang II receptor expression is highly modulated during development suggesting a role of these receptors in growth and organogenesis. With the aim to explore the expression pattern of Ang II receptors, we subcloned a PCR fragment of the AT1 receptor in the p-GEM T easy vector.   Genomic DNA was extracted from adult Wistar Kyoto rats. DNA (0.8 mg) was subjected to PCR amplification reaction by using the following primers: sense 5´gtcatgatccctaccctctacagc3´ and antisense 5´ccgtagaacagagggttcaggcag 3´. In order to separate proteins and primers, the PCR product (824 bp)  was purified  (Wizard, Promega). The identity of the amplification product was verified by restriction map using Ssp I and Pvu II restriction endonucleases. After purification, the band was subcloned into the p-GEM-T easy vector (Promega) by using the T4 DNA ligase. After  expansion of the vector in E.coli DH5a strain, the plasmid was purified. The insert was extracted of the vector with Eco RI and the band was excised from the gel and purified by precipitation. In this way, the subcloned fragment could be used in future for the preparation of a probe for Northern blot and related analysis.