INENCO   05446
INSTITUTO DE INVESTIGACIONES EN ENERGIA NO CONVENCIONAL
Unidad Ejecutora - UE
congresos y reuniones científicas
Título:
ANALISIS RESTROSPECTIVO DE FROTIS DE PACIENTES DEL NORTE DE SALTA, MEDIANTE PCR-RFLP, PARA LA IDENTIFICACIÓN DE SUBGÉNEROS DE LEISHMANIA
Autor/es:
ALMAZÁN, MARÍA CRISTINA; GIL, JOSÉ FERNANDO; MARCO, JORGE DIEGO; CAJAL, PAMELA; PORTELLI, MARCELA; JUAREZ, MARISA; KROLEWICKI, ALEJANDRO; BARROSO, PAOLA; HOYOS, CARLOS LORENZO; NASSER, JULIO RUBÉN
Lugar:
Mar del Plata
Reunión:
Congreso; X Congreso de Protozoología y enfermedades parasitarias; 2014
Institución organizadora:
Sociedad Argentina de Protozoología
Resumen:
Las leishmaniasis es causada por protozoos del género Leishmania. Se propuso que las especies circulantes en Salta son de los subgéneros Viannia y Leishmania, habiéndose reportado incluso infección por Leishmania (Leishmania) infantum en el Dpto San Martín. El objetivo del trabajo fue identificar, mediante PCR-RFLP, los subgéneros infectantes a partir de frotis de pacientes con leishmaniasis tegumentaria. Además, se analizó la posible relación entre los resultados de la PCR-RFLP y diagnóstico microscópico (DM), Intradermorreacción de Montenegro (IDRM) y tiempo de evolución (TE) de la lesión. Se analizaron 100 frotis de pacientes diagnosticados en el año 2002 y 2008-2012. Para la PCR se usaron los primers L5.8S 5?TGATACCACTTATCGCACTT3? y LITSRn 5?CTGGATCATTTTCCGATG3? y la digestión de los amplicones por RFLP se hizo con HaeIII. En la PCR 81 muestras fueron positivas, de estas el 93% (76/81) fue positivo para la restricción. En la totalidad de los casos, el subgénero identificado fue Viannia. Al analizar los resultados de PCR-RFLP en función del diagnóstico parasitológico, se vio que los frotis con DM 3+ tuvieron mayor positividad para la PCR, que aquellos 1+ y 2+ (p
rds']