Hemagglutinating encephalomyelitis coronavirus infection in Argentina: RT-PCR and genomic sequence studies.

BASSO W.; MORÉ G.; KIENAST M.; CAPUCCIO J.; QUIROGA M.A.; PIÑEYRO P.; MACHUCA M.; HIRANO N.; PERFUMO C. J.

Centrosul, Florianópolis, Brasil

Congreso; 13ª Congreso de ABRAVES (Associacao Brasilleira de Veterinarios Especialistas em Suinos).; 2007

Introduction                 Porcine hemagglutinating encephalomyelitis (PHE) is a viral disease affecting mainly pigs under 3 weeks old. The disease is caused by PHE coronavirus (PHE-CoV). This is the only known neurotropic CoV for pigs and pigs are the only naturally susceptible species (1). PHE-CoV was first isolated in Canada, in 1962, from the a brain of suckling piglets with encephalomyelitis, and later in England from piglets showing vomits, anorexia and depression, the syndrome was named “vomiting and wasting disease” (VWD) (1). Both clinical conditions, neurological and VWD were experimentally reproduced in pigs using the same field isolate. The infection has been reported in the major pig-raising countries of Europe, Asia and North America where it seemed to be endemic and clinical outbreaks seldom occur. However, clinically acute syndromes appeared in piglets less than 3 weeks-old when PHE-CoV infection occurred in herds with non-immune sows (1). In endemic herds, maternal antibodies via colostrum and milk protected offspring for 4-18 weeks, while older pigs developed an age-related resistance to the infection as a consequence of exposure to virus in the environment (1). Presumptive diagnosis can be achieved by epidemiological data including clinical history, signs, age-susceptibility and course of the disease correlated with histopathological findings. For definitive diagnosis, the virus should be isolated and identified. Currently, molecular tools such RT-PCR enables the detection of specific CoV RNA sequences from infected tissues (2, 3, 4). We describe and discusse the results of RT-PCR technique and DNA sequencing analysis of the RT-PCR products obtained from an outbreak of PHE-CoV in Argentina. Materials and Methods Reverse transcription-Polymerase chain reaction (RT-PCR):  RNA was isolated with a commercial kit (RNeasy QIAGEN GmbH. Hillden, Germany) according to the manufacturer’s instructions,  from brain samples (30 mg) of 7 symptomatic piglets (6 to 11 day-old) with non-suppurative encephalomyelitis, one asymptomatic piglet , and from a PK-15 cell culture suspension (30 µl) inoculated with a pool of tissues (tonsils, brain, lungs) from one symptomatic piglet . RNase free water and mastermix was used as negative control. The reaction was undertaken immediately after RNA isolation using the specific primer pair for coronavirus, Cor-FW 5’ 3’ (DNA) ACTCAAATGAATTTGAAATATGC and Cor-RV 5’ 3’ (DNA) TCACACTTTGGATAA TCCCA that amplifies a 251 pb fragment of the polymerase gene (3). The reaction was performed in a total volume of 50 µl containing 2 µl RNA-extract, 10 µl 5x QIAGEN One-Step RT-PCR buffer, 2 µl dNTPs mix (final concentration of 400 µM of each dNTP), 1.8 µl QIAGEN One-Step RT-PCR Enzyme Mix, 4 µM of each primer and RNase free water to 50 µl. The reaction was carried out in a thermal cycler (PCR Sprint Thermo Electron Corp) with an initial reverse transcription at 50º C for 30´, activation at 95º C for 15´, 40 cycles of amplification (30 sec. at 94º C, 30 sec. at 50º C and 1 min. at 72º C) and a final extension step at 72º C for 10 min. The amplicons were purified using the QIAquick PCR purification kit (QIAGEN) and sequenced on a MegaBase 1000 DNA sequencer (GE Healthcare). The obtained sequence was compared using NCBI BLAST. Results and discussion   By electrophoresis, a product of the expected size for CoV of about 250 bp was observed in all analyzed brain samples, although the band from the asymptomatic piglet was very narrow. No amplification was observed with the PK 15 cell culture sample. A constant 116 nucleotide sequence was obtained in all products from the symptomatic piglets and submitted to Genbank (accession number EF602436). It showed a 95% identity with the PHE-CoV strain VW572 complete genome (accession number DQ 011855) and with PHE-CoV RNA-directed RNA polymerase (pol) gene (accession number AF 124988). The detection of amplicons of about 250 bp with “pancoronavirus” primers in the brain samples is highly suggestive of PHE-CoV presence, because this is only the known neurotropic coronavirus in pigs (1, 4). The sequence analysis confirmed this observation.  In conclusion, results of molecular studies confirmed the presence of strains of a PHE-CoV in brains of piglets with vomiting and wasting disease syndrome. This is first report of molecular identification of PHE-CoV infection as porcine emerging infectious disease in Argentina and also in South American countries.