Looking for microorganisms with biotechnological potential from an Antarctic hydrocarbon-contaminated soil

MARTINEZ ALVAREZ L; RUBERTO L; VAZQUEZ S; CORIA S; HERNANDEZ E; DIAS R; MAC CORMACK WP

La Serena

Congreso; VII Congreso Latinoamericano de ciencia antártica; 2013

Instituto Antártico Chileno

BUSQUEDA DE MICROORGANISMOS CON POTENCIAL BIOTECNOLOGICO A PARTIR DE SUELOS ANTARTICOS CONTAMINADOS CON HIDROCARBUROS (Looking for microorganisms with biotechnological potential from an Antarctic hydrocarbon contaminated soil) Martinez Alvarez L1,2, Ruberto L1,2,3, Vazquez S2,3, Coria Silvia1, Hernandez Edgardo1, Dias Romina3, Mac Cormack WP1,2 1) Instituto Antártico Argentino, Balcarce 290, CABA, Argentina 2) Cátedra de Microbiología Industrial y Biotecnología, FFyB, UBA, Junín 956 6to piso CABA, Arg 3) Conicet, Av. Rivadavia 1917, CABA, Argentina Introduction An Antarctic hydrocarbon contaminated soil offers a combination of factors which turn it in an interesting source of stress adapted microorganisms. On one hand, Antarctic ecosystems provides to researchers the opportunity of finding previously no-described microorganisms. On the other hand, low temperature imposes to microorganisms the development of strategies to survive and grow in such conditions. Hydrocarbon contamination represents an additional challenge for microorganisms, exposing them to a potentially toxic substance that could be used as carbon and energy sources. All these factors could result in adaptation mechanisms (enzymes and other bioactive molecules) with potential biotechnological applications. Methods Twenty microbial strains were isolated from hydrocarbon-contaminated soil from Carlini station. Enrichment cultures using a saline basal medium with gasoil (1%) as sole carbon and energy source were incubated during 15 d at 15°C and250 rpm in a rotatory shaker. After the enrichment procedure, subsamples of the cultures were plated in the same culture medium supplemented with bacteriological agar (2%) and incubated at 15°C for 10 d. Colonies were picked out from these plates and subcultured for isolation. Genomic DNA of each isolated strain was extracted using available commercial kit (Mobio) and used as template for PCR amplification of 16S RNA gene for bacteria and ITS for fungi. Sequence of primers are shown in Table 1 and PCR conditions are shown in Table 2. The identification, accession number and similarity percentage of the closest relatives of each isolated bacterial, yeast and filamentous fungus are shown in the Results section. Table 1. Sequences of the primers used for PCR amplification Bacteria Primer sequence 27f 5´ AGAGTTTGATCMTGGCTCAG 3´ 1492r 5´ TACGGYTACCTTGTTACGACTT 3´ Yeasts/Fungi ITS4 5´ TCCTCCGCTTATTGATATGC 3´ ITS5 5´ GGAAGTAAAAGTCGTAACAAGG 3´ NL1 5´GCATATCAATAAGCGGAGGAAAAG 3´ NL4 5´GGTCCGTGTTTCAAGACGG 3´ Table 2. PCR conditions Temperature Time Number of cycles 94°C 3 min 1 94°C 1 min X 35 55°C 1 min 72°C 2 min 72°C 5 min 1 Results Bacteria Pseudomonas frederikbergensis Pseudomonas frederikbergensis JAJ28(T) 98.95% Pseudomonas brenneri Pseudomonas brenneri CFML97-391(T) 99.57% Pseudomonas amygdali Pseudomonas amygdali LMG 2123T (T) (Z76654) 98.3% Caulobacter henricii Caulobacter henricii ATCC 15253(T) 99.13% Variovorax ginsengisoli Variovorax ginsengisoli Gsoil3165 (T) (AB245358) 99.3% Sphingomonas aerolata Sphingomonas aerolata NW12(T) 99.35% Yeast Glaciozyma martinii Glaciozyma martinii strain CBS 8929 (AY040664) 99% Filamentous fungi Cadophora malorum Cadophora malorum (JQ796752) 100% Aspergillus sp Aspergillus versicolor strain UASWS0828 (JX139733) 100% Crytococcus laurentii Cryptococcus laurentii strain LANTA64 99% JN172923.1 Discussion Detection in the studied soil of a number of strains ascribed to the genus Pseudomonas can be considered as a common feature. Members of the Pseudomonadaceae family were reported as frequent inhabitants of hydrocarbon contaminated soils and hence, have been considered as appropriate candidates to be used in bioaugmentation process, mainly considering that they are typical r strategist, tending to quickly consume any abundant energy resource available. The isolation under low temperature conditions suggest their ability to grow as psycrotolerant microorganisms. Caulobacter is refered as a prosthecated bacterial genus well adapted to oligothrophic conditions (Wolf-Rainer et al, 1999). Its member inhabits mainly aquatic habitatss. This bacterial group and the previously mentioned Pseudomonadaceae family are thought to be responsible for mineralization of an important faction of dissolved organic material in aquatic environments. Caulobacter seems to play a relevant role in the organic matter cycling when nutrient concentration and temperature are low (Stanley et al 1987). Variovorax has been reported as a prevalent genus in Antarctic hydrocarbon contaminated soils, along with Pseudomonas, Sphingomonas and Rhodococcus (Saul et al 2005). The isolate obtained in this study, Variovorax ginsengisoli has been recently described as a novel species with denitrifying activity (Wan-Taek et al 2010). If this activity is also confirmed in the isolated variovorax strain, it could be interesting for the development of low-temperature bioremediation processes under anaerobic conditions. Sphingomonas aerolata has been reported for Antarctic soil (Aislabie et al 2000) and also in 4200 years-old ice (Chistner et al 2000, 2001). Members of the Sphingomonas genus are commonly reported as inhabitants of hydrocarbon contaminated soils from cold regions (Saul et al 2005). Glaciozyma yeast were isolated from cold environments all around the world, such as Alpine and Apenine glaciers and Antarctic soil and sea water. The two species belonging to the new genus were recently described (Turchetti et al 2011). A few months ago Hashin et al (2013) characterized an antifreeze protein from Galciozyma antarctica PI12, highlighting the biotechnological potential of this microorganism. A strain of Cadophora malorum which was isolated from green algae was reported as a producer of sclerosporins and hydroxylated sclerosporin derivatives. One of these compounds showed a weak fat-accumulation inhibitory activity against 3T3-L1 murine adypocites (Almeida et al 2010). A strain of Cadophora malorum was previously isolated by us (Ruberto et al 2011). The strain showed the production of an exudate exhibiting certain inhibitory activity on several other fungi, such us Diploidia mais. Fungi belonging to the genus Aspergillus are well known because its wide distribution and application in fermented food production, heterologous protein expression and toxins production. A psychrotolerant strain of this fungus could be an interesting model for the production of cold enzymes and other secondary metabolites. Finally, Crytococcus laurentii is considered a psychrophilic fungus who poorly growths above 30°C and shows an optimal growth temperature of 15°C. It is frequently found in Antarctic soil (Tosi et al, 2002). Strains of this fungus have been reported as atrazine-degrading microorganisms and have been proposed as bioremediation tools (Evy et al 2012) Conclusion Hydrocarbon contaminated soil from Antarctica is, because the stress factors that it represents, an interesting source of microorganisms with potential biotechnological applications. All the microorganisms identified in this work are related to others which have been reported as biotechnological tools. The finding of several members of the Pseudomonas genus in addition to the Caoulobacter, Sphingomonas and the Variovorax strains suggested that an association of these microorganisms prepeared in the laboratory could be an adequate option for the development of a biological tool for bioremediation of cold soils. Its natural occurrence as associated microorganisms could provide to the artificial microbial association some advantages at the moment of its reintroduction into the soil, overcoming the challenges that this procedure implies. The existence of synergic relationships among these strains must be studied in a next step. Because of its recalcitrant-organic-compounds degradation ability, the strain of Crytococcus laurentii could be added to the above mentioned bacterial association, reinforcing its degradation potential and providing some features typical of fungi, such as exoenzymes production, ability to degrade polymers and activity al low water activity. New screenings are necessary using different conditions in order to isolate other microorganisms that allow the complementation of the proposed bioremediation tool. In this sense, bacteria being k strategist (with the ability for a long term utilization of a scarce nutrient), such as Rhodococcus or Arthrobacter, seems to be appropriate partners for this association heading to a more complete biodegradation process. The isolated strains are going to be studied from different approaches (beyond their use as bioremediation tools) tending to identify their biotechnological potential. Cold active enzymes as well as novel or described secondary metabolites production, antibacterial and antifungal activity, antifreeze proteins or compounds will be investigated. This research should be conducted under stress conditions, such us low temperature, pollutant presence and coculture situations, heading to the potential expression of silent genes clusters. References ? Aislabie, J., Foght, J. & Saul, D. 2000. Aromatic hydrocarbondegrading bacteria from oil near Scott Base, Antarctica. Polar Biol 23,183?188. ? Celso Almeida, Ekaterina Eguereva, Stefan Kehraus, Carsten Siering, Gabriele M. König. 2010. Hydroxylated Sclerosporin Derivatives from the Marine-derived Fungus Cadophora malorum. J Nat Prod. 73(3): 476?478. doi:10.1021/np900608d. ? Christner, B. C., Mosley-Thompson, E., Thompson, L. G. & Reeve, J. N. 2001. Isolation of bacteria and 16S rDNAs from Lake Vostok accretion ice. Environ Microbiol 3, 570?577 ? Christner, B. C., Mosley-Thompson, E., Thompson, L. G., Zagorodnov, V., Sandman, K. & Reeve. J. N. 2000. Recovery and identification of viable bacteria immured in glacial ice. Icarus 144, 479?485. ? Evy A, Lakshmi V, Nilanjana D. 2012. Biodegradation of atrazine by Cryptococcus laurentii isolated from contaminated agricultural soil. J. Microbiol. Biotech. Res. 2:450-457 ? Hashim NHF, Bharudin I, Nguong DLS, Higa S, Bakar FDA, Nathan S, Rabu A, Kawahara H,Illias RM, Najimudin N, Mahadi NM, Murad AMA. 2013. Characterization of Afp1, an antifreeze protein from the psychrophilic yeast Glaciozyma Antarctica PI12. Extremophiles 17:63?73. ? Ruberto L, Levin G, Hernandez E, Stchigel A, Blanco M, Mac Cormack W. 2011. Isolation of a fungus from a hydrocarbon contaminated Antarctic soil and characterization of it exudate. XLVII Reunión Anual de la SAIB, Potrero de los Funes, San Luis, Argentina. October 30- November 2. ? Saul DJ, Aislabie JM, Brown CE, Harris L, Foght JM. 2005. Hydrocarbon contamination changes the bacterial diversity of soil from around Scott Base, Antarctica. FEMS Microbiology Ecology 53:141?155 ? Staley T, Konopka AE, Dalmasso P. 1987. Spatial and temporal distribution of Caulobacter spp. in two mesotrophic lakes. FEMS Microbiol Ecol45, 1-6. ? Tosi S, Casado B, Gerdol R, Caretta G. 2002. Fungi isolated from Antarctic mosses. Polar Biol 25: 262?268. ? Turchetti B, Thomas Hall SR, Connell LB, Branda E, Buzzini P, Theelen B, Muller WH, Boekhout T. 2011. Psychrophilic yeasts from Antarctica and European glaciers: description of Glaciozyma gen. nov.,Glaciozyma martini sp. nov. and Glaciozyma watsoniisp. nov. Extremophiles, 15:573?586 ? Wan-Taek I, Qing-Mei L, Kang-Jin L, Se-Young K, Sung-Taik L, Tae-Hoo Y. 2010. Variovorax ginsengisoli sp. nov., a denitrifying bacterium isolated from soil of a ginseng field. International Journal of Systematic and Evolutionary Microbiology, 60,1565?1569 ? Wolf-Rainer Abraham, Carsten StrOmpl, Holger Meyer, Sabine Lindholst, Edward R. B. Moore, Ruprecht Christ, Marc Vancanneyt, B. J. Tindali, Antonio Bennasar, John Smit, Michael Tesar. 1999. Phylogeny and polyphasic taxonomy of Caulobacter species. Proposal of Maricaulis gen. nov. with Maricaulis maris (Poindexter) comb. nov. as the type species, and emended description of the genera Brevundirnonas and Caulobacter. International Journal of Systematic Bacteriology, 49, 1053-1 073