INVESTIGADORES
ACHINELLY Maria Fernanda
congresos y reuniones científicas
Título:
Meloidogyen partityla infecting water oak (Quercus nigra) in Florida, USA.
Autor/es:
BRITO JANETE; SMITH T; ACHINELLY, M.F.; MONTEIRO TSA; DICKSON DW
Lugar:
Michigan
Reunión:
Congreso; 54th Annual Meeting of the Society of Nematologists; 2015
Institución organizadora:
Society of Nematologists
Resumen:
The pecan root-knot nematode Meloidogyne partityla (Kleynhans, 1986) was first found infecting pecan seedlings in a nursery in Florida in 2005. In 2009, we reported M. partityla infecting laurel oak (Quercus laurifolia) in Florida, USA. This was the first report of a plant host outside of the Junglandaceae family because prior to this report the only known hosts of this nematode were pecan, hickory, and walnut. In January 2009 and February 2015 roots of water oak (Quercus nigra) with galling resembling that commonly found with root-knot infection were found in two different home gardens, Alachua County, Florida. Infected roots were severely galled and showed very large and coalesced galls that were sometimes rotted. Egg masses were observed outside of the roots and females were detected inside of the galls. Species identification was performed using morphology of male stylet, selected character of second-stage juveniles, perineal patterns, and isozyme phenotypes. It was observed that males showed the region between the stylet cone and stylet shaft notably thickened. In the second-stage juvenile, the rectum was swollen and showed clearly deep longitudinal groves. Morphology perineal patterns of females, and also body, stylet, and tail length of second-stage juveniles and males, as well as the isozyme analysis were consistent with that previously reported for M. partityla. Results were confirmed using molecular analyses of the mitochondrial DNA (mtDNA) region between CO II and 16S and M. partityla species-specific primer set, which amplify a region from rDNA ITS between 18S and ITS 2. The mtDNA region was amplified with the C2F3/1108 primer set (Powers and Harris 1993) and produced a fragment of approximately 520bp for all females tested. The second loci used for identification was amplified with ITS-1 F (CGCAGTGGCTTGAACCGG) and a primer shown only to anneal in M. partityla, MpSpec (TGAACTTTTATTGGTGAAAG) (Stamler, 2009). The amplification size was approximately 530bp, which is in agreement with previous reports for this nematode species. To our knowledge, this is the first report of M. partityla occurring on Q. nigra. Studies are in progress to determine the ability of this population of root-knot nematode to infect pecan and the phylogenetic relationship between M. partityla infecting pecan with that infecting oaks.