Meloidogyne javanica infecting hops (Humulus lupulus) in Florida, Usa: a study case.

SUBBOTIN, J. DESAEGER; ACHINELLY , MARÍA F.,; BRITO, JANETE ANDRADE, ; QIU SAI

Albuquerque

Congreso; Annual Meeting Society of Nematologists, (SON); 2018

Society of Nematologists, (SON)

Humulus lupulus (Cannabaceae), commonly referred to as hops, are perennial, herbaceous climbing plants, native to temperate northern climates. Because of the high demand for hops from the micro-brewing industry in the Tampa-St. Petersburg area, it has recently been introduced in Florida. In October 2016, several hop plants that exhibited yellowing leaves and stunted growth were uprooted and showed severe root galling. Soil samples were collected for nematode extraction and showed high numbers of root-knot nematode second-stage juveniles (J2) (up to 1500 J2/ 200 cm3 soil). Root samples were sent to the Florida Department of Agriculture and Consumer Services, Division of Plant Industry Nematology Laboratory in Gainesville, FL. Species identification was performed using both morphological and molecular analyses. Configuration of the perineal patterns, morphometrics of selected characters of second-stage juveniles, including body, stylet and tail length, and the esterase phenotype (EST=J3), which is species-specific and malate phenotype (MDH=N1), were consistent with those reported in the original description of M. javanica. For molecular analyses, DNA was extracted from individual females and mitochondrial DNA was amplified with MORF (5? - ATCGGGGTTTAATAATGG G - 3?) and MTHIS (5? - AAATTC AATTGAAATTAATAG C - 3?) primer set. A fragment of approximately 740 bp was produced, which has been reported for M. incognita and M. javanica found in Florida. To further confirm the nematode species identification, we used the species-specific SCAR primer set Fjav (5?- GGTGCGCGATTG AACTGAGC - 3?) and Rjav (5? - CAGGCCCTTCAGTGGAACTATAC - 3?). This primer set yield a fragment of approximately 670 bp, which is identical to that previously reported for M. javanica. Additionally, NADH dehydrogenase subunit 5 gene was amplified using NAD5F2 (5?- TAT TTTTTGTTTGAGATATATTAG - 3?) and NAD5R1 (5?- CGTGAATCTTGATTTTCCATTTTT-3?) primer set. The obtained nad5 gene sequence (GenBank accession No. MH230176) was identical to the reference sequence of M. javanica.