Preconditioning of human dendritic cells with hyaluronic acid increases their migration capacity in vitro and in vivo

RIZZO MANGLIO; PICCIONI FLAVIA; MALVICINIA MARIANA; LLOYD RODRIGO; GARCIA MARIANA; ATORRASAGASTI CATALINA; BAYO JUAN; FIORE ESTEBAN; ANDRIANI OSCAR; TERRES MARCELO; GONZALEZ CAMPAÑA ARIEL; PODESTÁ GUSTAVO; ALANIZ LAURA; MAZZOLINI GUILLERMO

Oklahoma

Conferencia; 9 Conferencia Internacional de Ácido Hialurónico; 2013

Dendritic cells (DC) are the main cells responsible for initiating and coordinating the immune response to antigens and have been used as cancer vaccines. Cultured and activator in vitro prior to their use are very heterogeneous as well as the results of its clinical use. Once inoculated, immune response depends at least in part, on their ability to migrate to secondary lymphoid organs where they can trigger the antitumor response[1]. Hyaluronic acid (HA) is a component of extracellular matrix and regulates several biological processes [2]. Several works have shown that HA has the ability to modulate immune response in both physiological and pathological condition[3,4]. We previously observed that inoculation of low molecular weight (LMW) HA in mice with colorectal carcinoma stimulated tumor specific immune response [5]. Therefore, we thought to use LMW HA as a component of the "cocktail" of DC maturation with the aim of improve its efficiency to generate immunity. We focused our work in the evaluation of migratory capacity of DC using HA.Material and methods. Reagents. Endotoxin-free LMW HA of definite size (1?3 x105 Da) from CPN spol.s.r.o (Czech Republic) was kindly supplied by Farmatrade (Bs. As., Argentina). GM-CSF, TNF-α, CCL21 and CCL19 were from PeproTech; Poly(I:C) was from Invivogen. Blood and tumour tissue. Gastrointestinal cancer (GIC) patients and healthy volunteers were recruited. Peripheral blood sample and gastrointestinal tumoral tissues were obtained at the time of surgical resection at our institution. Informed consent was obtained from all patients in accordance with our institutional review board. Peripheral blood mononuclear cells derived dendritic cell. Peripheral blood mononuclear cells were isolated by Ficoll-Paque plus gradient. They were placed into 6-well plates up to 2 hours. After this, adhered cells were cultured for up to 7 days with GM-CSF and IL-4. In HA stimulation experiments, cells were treated from day 3 with LMW HA (50 μg/ml). At day 7, dendritic cells were pulsed with autologous tumor lysates (DC/TL) (200µg/106 cells/ml), with or without LMW HA (50 μg/ml). Poly(I:C) (10 µg/ml) were used as control activation. Cells were then centrifuged and used for experiments. Tumor lysates. Tumour tissues were frozen at -80°C and disrupted by 5 freeze-thaw cycles. To remove large debris, tumor lysates were centrifuged at 300 rpm for 10 min. The supernatant was collected and passed through a 0.2 μm filter. The protein concentration of the lysate was determined by Bradford assay. The resulting tumor lysates were aliquoted and stored at -30°C until use. Flow cytometric analyses. Staining and flow cytometric analyses of generated DC were carried out using standard procedures. Briefly, cells were stained with different conjugated antibodies as it follows: anti-CD11c (B-ly6), anti-MHC-II (G46-6), anti-CD40 (5C3), anti-CD80 L307.4, anti-CD86 (2331), anti-CCR7 (3D12), and their respective isotypes controls (BD Biosciences, San Diego, CA, USA) on ice for 30 min, washed thoroughly with PBS-1% BSA. Then, cells were fixed with 1% paraformaldehyde and subjected to flow cytometry (FACSCalibur, BectonDickinson-BD, USA). Data were analyzed using Cyflogic software. In vitro migration assays. Microchemotaxis Boyden Chamber unit were used. DC/TL treated or not with LMW HA (50mg/ml), or Poly(I:C) (10mg/ml) were placed in the upper chamber of the transwell unit. Chemoattractant medium containing 100 ng/ml of CCL21 was placed in the lower chamber of the transwell unit. The system was incubated for 4 hours at 37°C in a 5% CO2 humidified atmosphere. Cells were stained with DAPI and counted using UV microscopy with a 10x objective lens: 3 fields per well were analyzed and the mean number of cells/field ± SEM were calculated. In vivo migration assays. We used nude mice which had been implanted with a human tumor fragment subcutaneously. After 72 hours, DC/TL treated or not with LMW HA and stained with CM-Dil were inoculated subcutaneously into the back of mice, between tumour and nearest lymph node. At 48 hours mice were sacrificed, and tumor and lymph node were removed. We analyzed the presence of DC by flow cytometry. Zymography. MMP-2 and -9 activity was determined by zymography. Supernatant of culture from DC/TL treated or not with LMW HA was run on a 10% SDS PAGE containing 0.1% gelatin (Sigma-Aldrich). The gel was stained with Coomassie Brilliant Blue R-250 for 30 min at room temperature. Gelatinase activity was visualized by negative staining; gel images were obtained with a digital camera (Canon EOS 5D), and were subjected to densitometry analysis using Scion Image software (Scion Corporation, Frederick, MD). Relative MMP-2 activity was obtained by normalizing values to untreated samples (DC/TL). qPCR of TLR2, TLR4 and CD44 expression. TLR2 (Fw: GGGTTGAAGCACTGGACAAT; Rv:CTGCCCTTGCAGATACCATT), TLR4 (Fw: TGAGCAGTCGTGCTGGTATC; Rv: CAGGGCTTTTCTGAGTCGTC) and CD44 (Fw: GCGCAGATCGATTTGAATTAA; Rw: GTGCCCTTCTATGAACCCAT) expression were analyzed by real time PCR. Results: DC from healthy donors but not from GIC patients preincubated with LMW HA increased their maturation markers. DC/TL preincubated with LMW HA from healthy donors showed an increased ability to migrate toward CCL21 in a microchemotaxis Boyden Chamber system (fig. 2, A). In contrast, DC/TL from 6 patients increase their chemotaxis toward CCL21. Therefore we identified 3 groups: Health donors / Non-responder patients / Responder patients. DC/TL/LMW from healthy donors increase MMP-2 activity assessed in vitro. DC/TL/LMW HA from healthy donors and from migratory responder patients down-regulated HA receptors. In contrast, DC/TL from non responder patients up-regulated TLR2 and CD44. Conclusion: We suggest that LMW HA could be a potential adjuvant in immunotherapy DC-based protocols to enhance their migratory capacity.