Recreational water in Salta, Argentina, presence of pathogenic free living amoebae

MARÍA MERCEDES JUÁREZ; DIEGO GASTÓN SANGUINO JORQUERA; RAMIRO HUGO POMA; VERONICA IRAZUSTA; VERONICA BEATRIZ RAJAL

Singapur

Congreso; 15th International Congress of Bacteriology and Applied Microbiology, 15th International Congress of Mycology and Eukaryotic Microbiology and 17th International Congress of Virology; 2017

Singapore Society for Microbiology and Biotechnology (SSMB)

Objectives: This work aims to study the presence of pathogenic free living amoebae (FLA) in the Vaqueros River located in Salta,northwest of Argentina. We have based on four important facts: 1) there are three genera of FLA ubiquitous that can cause seriousand even fatal diseases in humans: Acanthamoeba, Naegleria y Balamuthia, 2) only Acanthamoeba includes pathogenic and nopathogenic strains (the other two genera have only one strain), 3) water is a possible vehicle of transmission, and 4) this aquaticambient is used extensively for recreational activities during spring and summer.Methods: Twenty-liter water samples were collected from four sites along the river during dry and wet season (October andDecember, respectively). Samples were concentrated by ultrafiltration using a portable device with a hollow fiber unit. The retentateobtained was cultured in Non-Nutrient Agar and incubated a 30 °C for 15 days, observing the development of colonies daily underthe optical microscope for its isolation.Later, each strain was growth axenically to be able to amplify a 400 bp 18S DNA fragment. The primers used [JDP1(5′GGCCCAGATCGTTTACCGTGAA3′) and JDP2 (5′TCTCACAAGCTGCTAGGGAGTCA3′)] allowed the classification ofAcanthamoeba strains into pathogenic and non-pathogenic after PCR products were sequenced.Results: A total of thirty two strains of FLA were isolated from all the environmental samples by its characteristic microscopicmorphology. Only nine of them were amplified by PCR, showing that they belong to Acanthamoeba genera. Although it is necessaryto carry out more studies for the identification of the strains that did not amplify, they most likely belonged to the Naegleria genus,because Balamuthia is not able to grow in a culture media rather than in a cell culture.Seasonal distribution showed that most of the FLA isolates were obtained during the wet season (75%), but all of the Acanthamoebastrains were only found in the dry season.The results of sequencing give high homology to isolates with strains that belonged to T4 genotype from the Genbank. Further,strains have also high homology between themselves.Conclusion: Like in previous studies, T4 demonstrated to be the predominant genotype in environmental samples, being in our casethe only one isolated. We wonder if this predominance of Acanthamoeba T4 species may be influenced by the fact that it is easilycultivated in the laboratory. A comparative metagenomic analysis could help to clear this question.T4 species are also predominant in clinical isolations, situations who demands more awareness within the public and healthprofessionals as this pathogen is emerging worldwide as a risk for human health.