First report of grapevine virus E infecting grapevine in Argentina

DEBAT, HUMBERTO; MOYANO, SABRINA; LUNA, FACUNDO; GOMEZ-TALQUENCA, SEBASTIAN; ZAVALLO, DIEGO; ASURMENDI, SEBASTIAN

JOURNAL OF PLANT PATHOLOGY

EDIZIONI ETS

Lugar: Pisa; Año: 2019 vol. 101 p. 1221 - 1222

1125-4653

Grapevine is the most important fruit crop in Argentina interms of cultivated area, as well as production volume. Todate, only 11 viruses have been reported to infect vine inArgentina (Lanza Volpe et al. 2015).Grapevine virus E (GVE) is a member of the genusVitivirus in the family Betaflexiviridae (Alabi et al.2013; Nakaune et al. 2008), which was tentatively linkedwith the rugose wood complex disease (Al Rwahnihet al. 2012). To investigate the occurrence of GVE inArgentina, a survey was conducted in grapevines fromthree regions (Mendoza?s North Oasis, East Zone andUco Valley) of Mendoza province, Argentina, duringthe 2017/2018 season. A total of 187 plants werescreened, including Vitis vinifera Malbec, Cot, Cabernetfranc, Cereza, Aspirant Bouchet, Chardonnay, Flame andPaulsen 1103 rootstock (V. berlandieri cv. Rességuier xV. rupestris cv. Lot). Total RNA from cambial scrapingsof all samples were purified by Spectrum Plant TotalRNA Kit (Sigma-Aldrich, USA), reverse transcribedusing random primers (6-mers) and tested by RT-PCRusing primers Fw:TCTTTCGAACYGAAGGTGCCAand Rv:GGGTCAATCAACCAACATGC, which weredesigned for the amplification of a 466 bp fragment ofa conserved region spanning part of the coat protein andNAB proteins CDS of GVE or grapevine virus L (GVL)(Debat et al. 2018). Results showed that two of the testedsamples (belonging to the Paulsen 1103 rootstock) tentatively presented GVE/GVL RNA. To confirm the identityof the RT-PCR positive samples, the products werecloned, bi-directionally Sanger sequenced and comparedwith GenBank available sequences. The partial nucleotide sequences sharing a 98.7% pairwise identity weredeposited as (MH580899, P3-MZ) and (MH580900, P5-MZ), showing highest identities ranging from 98.3 to98.7% with the GVE reference genome sequence isolatedfrom V. labruscana cv. Aki Queen in Japan (TvAQ7,AB432910) and only 79.5% with GVL (isolate RI,MH248020). To further support our findings we testedthe samples with additional primers Fw: GTTCAGATGCCAAAGCTGGG and Rv: GGCCCAATTGATAGCGGAGA, which allowed the amplification, cloningand sequencing of a 435 nt fragment of the replicaseencoding region of the virus. The resulting sequencesshared a 99.2% pairwise identity and presented a 97%(MK561024, P5-MZ) and 97.7% (MK561025, P3-MZ)highest identity with GVE TvAQ7, confirming that thedetected virus corresponded to GVE. The Argentineanisolates of GVE were found in plants not showing anyobvious symptoms of viral diseases. To our knowledge,this is the first report of GVE in Argentinian grapevines,which motivates its inclusion among the viruses considered in the grapevine certification scheme of Argentina.