Anthracnose-like disease mediated by Acremonium strictum in strawberry

RACEDO, J.; SALAZAR, S.M.; CASTAGNARO, A.P.; DÍAZ RICCI, J.C.

GenBank

GenBank

Año: 2011 vol. 1 p. 1 - 1

0000 0000

Sarocladium strictum isolate SS71 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence GenBank: JN098488.1 FASTA Graphics Go to: Features SequenceLOCUS JN098488 489 bp DNA linear PLN 25-JUL-2011 DEFINITION Sarocladium strictum isolate SS71 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence. ACCESSION JN098488 VERSION JN098488.1 GI:340548708 KEYWORDS . SOURCE Sarocladium strictum ORGANISM Sarocladium strictum Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Sordariomycetes; Hypocreomycetidae; Hypocreales; mitosporic Hypocreales; Sarocladium. REFERENCE 1 (bases 1 to 489) AUTHORS Racedo,J., Diaz Ricci,J.C., Castagnaro,A.P. and Salazar,S.M. TITLE Anthracnose-like disease mediated by Acremonium strictum in strawberry JOURNAL Unpublished REFERENCE 2 (bases 1 to 489) AUTHORS Racedo,J., Diaz Ricci,J.C., Castagnaro,A.P. and Salazar,S.M. TITLE Direct Submission JOURNAL Submitted (08-JUN-2011) Instituto de Quimica Biologica, Instituto Superior de Investigaciones Biologicas (INSIBIO)- CONICET, Chacabuco 461, S. M. de Tucuman, Tucuman 4000, Argentina FEATURES Location/Qualifiers source 1..489 /organism="Sarocladium strictum" /mol_type="genomic DNA" /isolate="SS71" /host="strawberry" /db_xref="taxon:5046" /country="Argentina" /collected_by="S.M. Salazar" /identified_by="J. Racedo" /PCR_primers="fwd_name: its1, fwd_seq: gccgtaggtgaacctgcgg, rev_name: its4, rev_seq: gcctccgcttattgatatgc" rRNA 489 /product="internal transcribed spacer 2" ORIGIN 1 gaccggcatt ccgagggcct aggctctcca cccattgtga acatacctat cgttccctcg 61 gcgggctcag cgcgcggtgc ctccgggctc cgggcgtccg ccggggacaa ccaaactctg 121 attttattgt gaatctctga ggggcgaaag cccgaaaaca aaatgaatca aaactttcaa 181 caacggatct cttggctctg gcatcgatga agaacgcagc gaaatgcgat aagtaatgtg 241 aattgcagaa ttcagtgaat catcgaatct ttgaacgcac attgcgcccg ccggcactcc 301 ggcgggcatg cctgtccgag cgtcatttca accctcagga ccccctttcg ggggggacct 361 ggtgctgggg atcagcggcc tccgggcccc tgtcccccaa attgagtggc ggtcgcgccg 421 caacctcccc tgcgtagtag cacacctcgc accggagagc ggctcggcca cgccgtgaaa 481 cccccaatt