Pathogenic Acanthamoeba in recreational water in Salta, Argentina

JUAREZ, MARÍA MERCEDES; IRAZUSTA VERÓNICA; SANGUINO JORQUERA, DIEGO; RAJAL VERÓNICA; POMA, RAMIRO HUGO

carolina del Norte

Congreso; Water Microbiology Conference, Water and Health Conference; 2017

Free living amoebae (FLA) are ubiquitous microorganisms that cause several pathologies. Some of them are devastating, like keratitis caused by Acanthamoeba or encephalitis caused by Acanthamoeba, Naegleria or Balamuthia. Water is the media that transport the infective elements to the brain or eyes. Then, the use of water for recreational activities can be considered a risk to acquire these diseases. We have studied the presence of FLA in Vaqueros River, Salta, Argentina. Thisaquatic ambient is used extensively for recreational activitiesduring spring and summer. Water samples (20 L) were collected from four sites along the river, during the dry season (October) and the wet season (December). Later,ultra-filtered through a dialysis membrane to concentrateand the retentatecultured in a Non-Nutrient Agar. We have isolateda total of thirty two strains of FLA from all the environmental samples, by its microscopic morphology. The strains isolated were growth axenically and a 400 bpsegment of the 18S genomic DNA was amplified using JDP1 (5¡ÇGGCCCAGATCGTTTACCGTGAA3¡Ç)y JDP2 (5¡ÇTCTCACAAGCTGCTAGGGAGTCA3¡Ç) primers for the genotypic classification ofAcanthamoebastrains. Last, the PCR products were sequenced.The results showed that from the thirty two strains, only nine were Acanthamoeba. The other strains most likely belonged to theNaegleria genus, because Balamuthia is not able to grow in a culture media rather than in a cell culture.Although most of the FLA isolates were made in the wet season (75%), the Acanthamoeba strains were only found in the dry season.Sequence analysis in these isolates showed high homology between them and strains belonged to T4 genotype strains from the Genbank.Overall, T4 is the predominant genotype in both clinical and environmental samples. The widespread distribution of pathogenic Acanthamoeba T4 across the environmental sources and the increasing number of contact lens wearers, demand more awareness within the public and health professionals as this pathogen is emerging worldwide as a risk for human health. One issue not yet considered, is the ease of growing the Acanthamoeba T4 species, this may be a cause that influences its predominant environmental findings. Comparison of this type of studies with metagenomic analyzes could help answer this question.