Sand flies captures and identification of Leishmania subgenus in Giemsa-Stained slides of patients from five localities of Salta, Argentina.

ALMAZÁN, MARÍA CRISTINA; GIL, JOSÉ FERNANDO; CHANAMPA, MARIANA ; BARROSO, PAOLA; NASSER, JULIO RUBÉN; COPA, NOEMÍ GRISELDA; ORESTE, FERNANDA; CASTILLO, GABRIELA

Puerto Iguazú

Simposio; International Symposium on Plebotominae; 2014

REDILA, Ministerio de Salud-Presidencia de la Nación

Leishmaniasis is a disease which is endemic in 88 countries and in Argentina remains endemic in 9 provinces. It is caused by several species of flagellates parasites of the genus Leishmania. The wide spectrum of clinical manifestations depends on Leishmania spp and the host inmuno-response. The parasite is transmitted by sand flies of Family Psychodidae, Subfamily Phlebotominae. In Argentina, many sand flies have been described, being the most important and suspected vector Nyssomyia neivai because it showed natural infection with Leishmania parasites. In our country some Leishmania species were isolated Leishmania (Viania) braziliensis, Leishmania (Leishmania) amazonensis, L. (V.) guyanensis, L. (V.) panamensis associated to tegumentary leishmaniasis (TL); and L. (L.) infantum associated to visceral leishmaniasis. The aim of this work was to explore the sand flies presence from five localities of the north of Salta. Besides, patient samples from these areas, were analyzed in order to identify the causal agent. Sand flies were collected during one or six nights with CDC light traps. Traps were placed a meter above the soil and left since 18 pm to 7 am. Species identification of all collected sand flies was made by morphology of spermatheca and cibarium or external genitalia. Leishmania subgenus determination was carried out by PCR-RFLP assay. Seventy-six giemsa-stained samples diagnosed for TL in 2002 at Instituto de Investigación de Enfermedades Tropicales located in Orán, Salta were used. DNA extractions were made by a lysis buffer. The PCR primers L5.8S 5?TGATACCACTTATCGCACTT3? and LITSRn 5?CTGGATCATTTTCCGATG3? were used. For RFLP, amplicons were digested with HaeIII enzyme. We captured 1352 phebotomines, of which Ny. neivai represent the 76%, Migonemyia migonei 12%, Evandromyia cortelezzii complex 11% and Psathyromyia shanonni 1%. Ny. neivai was present in all localities studied. By PCR-RFLP, Viannia subgenus was the only identified. Regarding geographical cases distribution, 97% of them were from Orán, being this area the site with more cases and highest sand flies amount. Three sandflies species found in this study are considered as potential cutaneous leishmaniasis vectors, particularly of Viannia subgenus parasites. We propose PCR-RFLP in order to enhance the traditional diagnostic just because knowing the leishmaniasis causal agents would improve the treatment assignation and we suggest sandflies surveillance in these localities.